CleanPlex Dual-Indexed PCR Primers for Illumina, Set A (96)

£416.00

96 reactions

Product Code: 716006 Category: Tag:

The CleanPlex Dual-Indexed PCR Primers for Illumina are high-quality ready-to-use PCR primers for Illumina library construction. They are compatible and designed for use with all CleanPlex and CleanPlex UMI NGS Panels to construct targeted libraries for sequencing on an Illumina NGS platform.

Primer Sequences:

i5 Indexed Primers

5’AATGATACGGCGACCACCGAGATCTACACXXXXXXXXACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3′

i7 Indexed Primers

5’-CAAGCAGAAGACGGCATACGAGATXXXXXXXXGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3’

Note:

Please refer to CleanPlex NGS Panel User Guide for instructions on using CleanPlex Dual-Indexed PCR Primers for Illumina

For Research Use Only. Not for use in diagnostic procedures.

CleanPlex NGS Panel User Guide

CleanPlex is the the most advanced PCR amplicon sequencing technology.

What is Targeted Sequencing (Resequencing) / Target Enrichment?
During Target Enrichment, the target DNA sequences are either directly amplified (amplicon or multiplex PCR-based) or captured (hybrid capture-based) and then subsequently sequenced using DNA sequencers. This process is followed by Targeted Sequencing, also known as Resequencing, where only the region of interest containing the target DNA is sequenced instead of a whole genome.

Why Target Enrichment?
Whole genome sequencing (WGS) and its corresponding whole genome amplification (WGA)’s applications are more suited for research and discovery. While Targeted Sequencing and Target Enrichment are preferred in a fast-growing clinical and industrial context where cost and speed are key.

CleanPlex NGS Target Enrichment Amplicon Sequencing Technology
CleanPlex technology is an ultra-high multiplex PCR amplicon-based target enrichment technology for NGS targeted sequencing (amplicon sequencing as opposed to hybrid capture-based sequencing). It features a highly advanced proprietary primer design algorithm, an exceptionally uniform multiplex PCR amplification chemistry and an innovative, patented background cleaning chemistry. Together, they allow CleanPlex Ready-to-Use and Custom NGS Panels to break the limits of existing PCR amplicon-based and hybrid capture-based target enrichment technologies.

Feature Highlights:

  • High accuracy with lower sequencing cost: super high amplification uniformity and super low PCR background noise
  • Easily automated: single-tube and 3-hour workflow with minimal hands-on time
  • High compatibility: suited for difficult samples (degraded FFPE, cfDNA) and major sequencing platforms (Illumina, Ion Torrent, MGISeq)
  • Extreme sensitivity: down to single cell level direct amplification

  • Excellent panel size scalability from a few amplicons to over 20,000 amplicons in a single multiplex PCR pool

CleanPlex multiplex PCR-based NGS target enrichment workflow.
CleanPlex Ready-to-Use and Custom NGS Panels allow high-quality target-enriched NGS libraries to be easily and quickly prepared for amplicon sequencing.

CleanPlex background cleaning chemistry.
The CleanPlex chemistry’s streamlined protocol can be completed with 3 simple steps, each consisting of a thermal cycling or incubation reaction followed by a library purification using magnetic beads.

    Step 1: targets of interest are amplified in a multiplex PCR reaction.
    Step 2: primer-dimers, non-specific PCR products, and complex molecular-debris are biochemically removed in a digestion reaction.
    Step 3: libraries are barcoded with sample indexes and amplified in a PCR reaction.

High performance powered by background cleaning
Non-specific PCR products and primer-dimers are biochemically removed using the proprietary CleanPlex digestion chemistry. This ensures that only DNA sequences of interest are converted into NGS library molecules, resulting in highly efficient use of sequencing reads.

Effective removal of PCR background.
Libraries were prepared using the CleanPlex OncoZoom Cancer Hotspot Panel with (blue trace) or without (red trace) using the CleanPlex digestion reagent and examined using an Agilent® Bioanalyzer®. Without CleanPlex digestion, significant PCR background was formed, which would result in low mapping rate and poor on-target rate and require more sequencing reads to obtain adequate data. With CleanPlex digestion, nearly no background was generated, producing a sharp and clean library peak in the Bioanalyzer trace. The proprietary CleanPlex digestion chemistry is essential for removing undesired side products formed during multiplex PCR amplification of target sequences.

Discover more with CleanPlex NGS Panels
• Multiplex 20,000+ amplicons per reaction
• High target design rate
• High coverage uniformity
• High on-target rate
• High sensitivity (1% LOD with 10 ng input)

Use less input and resources to reduce costs
• Inputs as low as 10 ng
• Fast 3-hour protocol
• Simple, streamlined workflow
• Efficient use of NGS reads

Menu